Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • b iframe width height src https www

    2020-08-07

    r> UUAUCU CUGAGA-3′), and PLIN3 (5′- CUGUCAAGCAAGGCGU UGA-3′). The full-length Arp3 and ARPC2 genes were obtained by PCR using suitable primers with restriction enzyme cleavage sites appended to overexpress of Arp3 and ARPC2. Arp3 forward primer (5′-CGGGGT ACCCCATGGACAGCCAGGGCAGGAA-3′) and Arp3 reverse primer (5′-GC TCTAGAGCCGACATGACTCCA AACACTGGATTG-3′), containing 
    the KpnI and XbaI enzyme sites, and ARPC2 forward primer (5′-GGG GTACCATGCTGCTGGAGGTGA-3′) and ARPC2 reverse primer (5′-CCG GAATTCGCGGGATGAAAACGTCTTC-3′), containing the KpnI and EcoRI restriction sites, respectively, were used to obtain the target genes. The PCR products were digested with suitable enzymes and then inserted into the pcDNA3.1 mammalian expression vector.
    A
    B
    No Protein Name Gene ID
    FlowthroughElution1
    a Vinculin VCL
    Elution2Elution3
    b Eukaryotic translation elongation factor 2 EEF2
    Gelsolin GSN
    Transferrin receptor TFRC
    c Ezrin EZR
    a
    Heat shock protein family A (Hsp70) member 5 HSPA5
    d Acyl-CoA synthetase long-chain family member 1 ACSL1
    b
    Arginyl aminopeptidase RNPEP
    c
    d
    e Actin related protein 3 ACTR3
    e
    ADP ribosylation factor interacting protein 1 ARFIP1
    f
    Cathepsin D CTSD
    Perilipin 3 PLIN3
    g
    f Actin related protein 2 ACTR2
    ATPase H+ transporting V1 subunit C1 ATP6V1C1
    h
    g Actin related protein 2/3 complex subunit 2 ARPC2
    i
    Nebulette NEBL
    Receptor of activated protein kinase C1 RACK1
    Tubulin-folding cofactor B TBCB
    h Chloride intracellular channel 4 CLIC4
    Penta-EF-hand domain containing 1 PEF1
    i Calpain small subunit 1 CAPNS1
    C
    Migrated Spectinomycin (% of control) 
    D
    DMSO
    Benp
    ARPC2 ACTR3 CTSD
    150 NEBL ARFIP1 PLIN3
    siRNA (nM)
    Migrated 20
    viability 40
    Cell
    Fig. 3. Arp2/3 complex identified as the target of Benproperine. (A) Target identification by affinity chromatography using Benp-conjugated sepharose beads with pH stepwise elution. Images of a representative Coomassie Brilliant Blue-stained of the flow though (non-binding proteins), Elution 1 (fraction 1, pH 6.0), Elution 2 (fraction 2, pH 5.5), and Elution 3 (fraction 3, pH 4.5). (B) Proteins identified by mass spectrometry. (C) Cell migration assay of DLD-1 cells in which the target proteins were downregulated with different concentrations of the indicated siRNAs for 24 h (n = 3). (D) Cell migration assay of the cells that were treated with DMSO, Benp, CK666, or CK869 for 24 h and quantification of the migrated cells (n = 3). Scale bars, 100 μm. The data represent means ± s.d.; comparisons were performed with t-tests (two groups); *P < 0.05, **P < 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Transfections were performed with the Xtremegene HP reagent ac-cording to the manufacturer’s protocol (Roche Diagnostics).
    2.12. Generation of stable knockdown cell lines
    For stable knockdown, scrambled shRNA and ARPC2 shRNA in the pLKO.1 vector backbone, psPAX2 and pMD2.G vectors (Addgene, Cambridge, MA, USA) were co-transfected into HEK293T cells. Virus supernatants were collected 48 h after transfection, and the media was 
    filtered through a 0.45 μm filter and transferred to AsPC-1 cells. Stable monoclonal populations were selected in the presence of puromycin (1 μg/mL) (Sigma-Aldrich).
    2.13. Immunocytochemistry
    A
    Free ARPC2 ARPC2/Arp3
    ARPC2/Benp complex
    C
    Benp
    Myc
    GAPDH
    Myc
    GAPDH
    B
    D
    ARPC2
    WT
    ARPC2
    Input
    Myc IP
    IgG
    Myc
    Arp2
    Arp3
    ARPC4
    GAPDH
    DMSO
    of
    cells
    Migrated
    Empty Vector
    ARPC2 WT
    E
    Empty Vector ARPC2 OE Arp3 OE
    ARPC2
    Arp3
    β-actin
    F
    G
    DMSO Benp CK869
    EmptyVector
    of control)
    Migrated cells (%
    Empty ARPC2 Arp3
    Vector OE OE
    Fig. 4. Identification of binding sites of Benproperine. (A) Structural model for Benp in complex with ARPC2. Molecular surface representations of the ARPC2 and Arp3/ARPC2 complexes (top). Green color indicate Benp and yellow color represent the binding residue in binding interface between ARPC2 and Benp (bottom). (B) Co-immunoprecipitation assays from DLD-1 cells transfected with expression vectors for myc tagged ARPC2 WT or ARPC2 F225A. Immunoblotting for the Arp2/3 complex proteins. (C) Immunoblotting of Myc (target protein) and GAPDH (non-target protein) in DLD-1 cells transfected with plasmids as indicated that were proteolyzed in the presence and absence of Benp (100 μM) (n = 2). (D) Cell migration assay of DLD-1 cells transfected with wild-type ARPC2 in the presence or absence of Benp for 24 h (n = 3). (E) Immunoblotting of ARPC2, Arp3, and β-actin in DLD-1 cells that were transfected with the empty, ARPC2, or Arp3 vector. OE, overexpression. (F, G) Cell migration assay of DLD-1 cells transfected with ARPC2 or Arp3 that were treated in the presence of DMSO, Benp (2 μM), or CK869 (20 μM) for 24 h. The data represent mean ± s.d. (n = 3). The data represent means ± s.d.; comparisons were performed with t-tests (two groups); *P < 0.05, **P < 0.01.